Traducción
■■■■■■■■■■■■■■
Palabra por palabra
sin traducción directa |
Ejemplos
En 2003 se completó el triplete Liga ACB, Copa y Euroliga. | In 2003 it completed a Liga ACB, Cup and Euroleague treble. |
Está constituida por tres polipéptidos diferentes, el triplete de neurofilamentos. | They consist of three distinct polypeptides, the neurofilament triplet. |
¿Para qué aminoácido codifica el triplete GTT? | Which amino acid does the nucleotide triplet GTT code for? |
Polarización cromosférica en el triplete infrarrojo fotosférico del oxígeno en el Sol. | Chromospheric polarization in the photospheric solar oxygen infrared triplet. |
TGTCATGCATCCGTCATCACTGAC - El triplete ATG determina el principio del mensaje y el triplete TGA, el final. | TGTCATGCATCCGTCATCACTGAC - The ATG triplet determines the beginning of the message and the TGA triplet its end. |
Sébastien Ogier ha encabezado el triplete de Volkswagen Motorsport después de la primera jornada del 72nd LOTOS Rallye de Polonia. | Sébastien Ogier headed a Volkswagen Motorsport 1-2-3 after Friday's opening leg of 72nd LOTOS Rally Poland. |
Resultó ser un gran día de apertura para los seguidores locales, ya que Teemu Suninen completó el triplete finlandés. | It proved to be a great opening day for the home rally fans as Teemu Suninen completed a Finnish lock-out of the top-three places. |
Los neurofilamentos están compuestos por tres subunidades principales, llamados el triplete de neurofilamentos, con masas moleculares de 68 kD, 160kD y 200 kD. | Neurofilaments are composed of three major subunits referred to as the neurofilament triplet, with molecular weights of 68 kD, 160kD and 200 kD. |
En el Rally de Australia Volkswagen consiguió el triplete definitivo con victoria para Sebastien Ogier, segundo puesto para Jari-Matti Latvala y último cajón del podio para Andreas Mikkelsen. | The Volkswagen Rally Australia got the final triplet victory for Sebastien Ogier, second place for Jari-Matti Latvala and final step of the podium for Andreas Mikkelsen. |
Neuville lideró el triplete de Hyundai, superando a Andreas Mikkelsen por 4,9 segundos, mientras que Hayden Paddon se llevó el tercer puesto, 12,1 segundos por detrás del ganador. | Neuville headed a Hyundai 1-2-3, fending off Andreas Mikkelsen by 4.9sec while Hayden Paddon surged up the order to claim third, 12.1sec off the lead. |
Palabra al azar
¡Tirar los dados y aprender una palabra nueva ahora!
¿Quieres aprender inglés?
¡Aprende inglés gratis!
